Users.uoa.gr

CURRENT MICROBIOLOGY Vol. 51 (2005), pp. 211–216DOI: 10.1007/s00284-004-4430-4 CurrentMicrobiologyAn International Journalª Springer Science+Business Media, Inc. 2005 PCR Detection of Oxytetracycline Resistance Genes otr(A) and otr(B) inTetracycline-Resistant Streptomycete Isolates from Diverse Habitats Theodora L. Nikolakopoulou,1 Sharon Egan,2 Leo S. van Overbeek,3  Gilliane Guillaume,4 Holger Heuer,5 Elizabeth M.H. Wellington,2 Jan Dick van Elsas,3 Jean-Marc Collard,4 Kornelia Smalla,5 Amalia D. Karagouni1 1National and Kapodistrian University of Athens, Faculty of Biology, Department of Botany, Microbiology Group, 157 81 Athens, Greece2University of Warwick, Department of Biological Sciences, Coventry CV4 7AL, United Kingdom3Biological Centre, Department of Microbial Ecology, Groningen University, P.O. BOX 14, 9750 AA Haren, The Netherlands4Scientific Institute of Public Health, Rue Juliette Wytsmanstraat 14, B-1050, Brussels, Belgium5Federal Biological Research Centre for Agriculture and Forestry (BBA), Messeweg 11-12, 38104 Braunschweig, Germany Received: 4 August 2004 / Accepted: 4 September 2004 Abstract. A range of European habitats was screened by PCR for detection of the oxytetracyclineresistance genes otr(A) and otr(B), found in the oxytetracycline-producing strain Streptomyces rimosus.
Primers were developed to detect these otr genes in tetracycline-resistant (TcR) streptomycete isolatesfrom environmental samples. Samples were obtained from bulk and rhizosphere soil, manure, activatedsludge and seawater. The majority of TcR streptomycetes originated from bulk and rhizosphere soil.
Fewer TcR streptomycetes were isolated from manure and seawater and none from sewage. By PCR,three out of 217 isolates were shown to contain the otr(A) gene and 13 out of 217 the otr(B) gene.
Surprisingly, these genes were detected in taxonomic groups not known as tetracycline-producingstrains. The majority of the otr gene–carrying strains was assigned to S. exfoliatus or S. rochei andoriginated from all habitats from which TcR streptomycetes were obtained. Our results indicated that theoccurrence of otr(A) and otr(B) genes in natural environments was limited and that otr(B), in com-parison to otr(A), seemed to be more common.
Keywords: tetracycline resistance genes, antibiotics, otr(A), otr(B), streptomycetes, PCR detection.
Tetracyclines are clinically important drugs and the bacterium fortuitum and M. peregrinum, as well as development and spread of resistance remains a major pathogenic streptomycetes [18]. So far, tetracycline concern. Of particular interest are the natural reser- resistance in naturally occurring streptomycetes has voirs of such resistance genes. Recent studies have attempted to evaluate the impact of tetracycline use on In this study, we assessed the prevalence of the two communities of Gram-negative [1, 14] and Gram-po- oxytetracycline resistance genes, otr(A) and otr(B), sitive bacteria [2, 22] in various natural environments.
found on the chromosome of oxytetracycline producer Reports on the presence of tetracycline resistance Streptomyces rimosus, in streptomycete populations of genes in streptomycetes are limited to the producer environmental samples [7, 16]. The habitats selected strains, such as Streptomyces rimosus [3] and S. au- represented sites with either a history of pollution or reofaciens [4], selected non-producing species such as antibiotic selective pressure or more pristine environ- Streptomyces lividans 1326 [5] and pathogenic ac- ments and comprised of bulk and rhizosphere soil, sea- tinomycetes with clinical importance, such as Myco- water, manure, and sewage. In a comprehensive surveyof the occurrence of antibiotic resistance genes and their mobility, the same samples were analysed using a Present address: Department of Biological Sciences, University of multiphasic approach for antibiotic resistance genes Idaho, Moscow, ID 83844-3051, USACorrespondence to: Amalia D. Karagouni; email: [email protected] typically found in non-producing bacteria [12, 24].
Table 1. Streptomycetes and plasmids used in this study Table 2. Origin of environmental samples that were studied Description and origin of sample (Sample No) Dossenheim (Germany); plantomycin (active compound streptomycin sulphate) treated soil (1)Dossenheim; untreated soil (2)Drotwichn (UK), sewage sludge treated soil (3)Costwolds (UK); limestone-based soil fallow (sparse vegetative cover) (4) Dossenheim, grass grown on plantomycin (active compound streptomycin) treated soil (5)Dossenheim; grass grown on untreated soil (6)Ens (The Netherlands); white radish (Raphanus sativus L. rettich) grown on CuSO4 treated soil (7)Ens; white radish (R. sativus L. rettich) grown on untreated soil (8) Broiler chicken grown on flavomycin-treatcd food (Germany) (9)Broiler chicken grown on untreated food (Germany) (10)Layer chicken grown on Zn-bacitracin-treated food (Germany) (11)Layer chicken grown on untreated food (Germany) (12) Brussels; Hospital wastewater treatment facility (Erasmus Hospital; Belgium) (13)Ghent; Hospital wastewater treatment facility (Maria Middelares Hospital; Belgium) (14)Wavre; treatment plant of the Dyle valley (population, industry, university; Belgium) (15)Rosi›re; treatment plant of Lasne (population, industry, Belgium) (16) Athens; wastewater treatment outflow in Saronicos Gulf (Greece) (17)Volos, Pagasiticos Gulf; fishfarm tetracycline administered at regular base (Greece) (18)Eretria (Evia Island): pristine (Greece) (19)Fleves Island; pristine (Greece) (20) Serial dilutions (100 to 10–6) were plated on the streptomycete selectivemedia RASS and AGS [9], supplemented with 10 lg mL)1 tetracycline Bacterial strains and culture conditions. Streptomycetes and E. coli and 100 lg mL)1 cycloheximide, to inhibit fungal growth and strains carrying tetracycline resistance genes were used in this study incubated at 28°C for 3 to 10 days. Colonies with different color and (Table 1). These strains were grown on Tryptic Soy Agar (TSA, morphology (maximally 24 individual colonies from each sample) Oxoid) and Luria Agar (Oxoid), respectively, amended with 50 lg were purifired and spore suspensions of isolates were stored in 20% mL)1 of tetracycline at 27°C. Strains of S. griseus, S. coelicolor and S.
fradiae with phenotypes sensitive to tetracycline were also employedand were grown on TSA at 27°C.
Denaturing Gradient Gel Electrophoresis (DGGE). The 16S rRNAgene–based PCR-DGGE method, as described by Heuer et al. [11], was Sampling and selective isolation of TcR streptomycetes. Twenty applied to all TcR streptomycete isolates obtained. For this purpose, European sampling sites were selected and samples were taken from genomic DNA was extracted from streptomycete isolates, using a bulk soil, rhizosphere soil, manure, activated sludge and seawater protocol described by Hopwood et al. [13] and subjected to (Table 2). The sampling sites and the sample processing methodology amplification using the actinomycete specific primers F243 and have been described in detail by Heuer et al. [12] and van Overbeek R513gc [11]. Amplicon profiles from all isolates were used in order et al. [24]. Sampling from four different locations for each habitat gave to cluster isolates into groups and reduce the number of isolates used the opportunity to include two samples from habitats under selective for further identification analysis, by selecting only representatives pressure, for example, pollution, heavy metals or antibiotic treatments from each one of the assigned groups.
and two samples from sites that were not known to be receivingtreatments. Bacterial suspensions of all samples were placed in a water Characterization of culturable resistant phenotypes. Identification bath for 2 h at 60°C to eliminate the growth of other bacterial groups of isolates was carried out using 41 morphological and physiological and to enhance the possibility of heat-tolerant streptomycetes to grow.
diagnostic characters for phenotypic identification [15]. Isolates were T.L. Nikolakopoulou et al.: Distribution of Oxytetracycline Resistance identified using the probabilistic identification matrix of Williams etal. [25]. In this scheme, three identification statistics were used: theWilcox probability, taxonomic distance and its standard deviation [25].
Primer design and PCR detection of otr genes. PCR technique wasemployed to detect otr(A) and otr(B) gene sequences among the TcRstreptomycetes isolated in this study. Selected PCR primer sets weretested for amplification of their respective target genes. They were alsoassessed for the absence of any PCR product when targetingtetracycline-sensitive containing tetracycline resistance genes (Table 1), non-homologousto otr genes. Genomic DNA was extracted from streptomycete isolates,as described by Hopwood et al. [13] and plasmid DNA was extractedfrom the TcR E. coli reference strains according to a standard protocol[21]. PCR amplification was performed in a Thermal Cycler (Genius,Techne, Cambridge, UK), and the reaction mixture was as follows:Tris-HCl pH 8.3, 50 mM; KCl 50 mM; MgCl2 2.5 mM; 0.1 mg mL)1bovine serum albumin (Sigma); 200 lM of each deoxynucleoside Fig. 1. DGGE analysis of 16S rRNA gene amplicons from TcR triphosphate; 2.5 % dimethyl sulfoxide; 100 nM of each oligo; 1 U of streptomycete isolates. Lanes 2, 4, 5, 8: amplicons from strains that TaqPolymerase (Promega, Madison, WI) and 1 lL (ca. 20 ng) of belong to group B; lanes 1, 3, 6, 7, 9, 10, 11: amplicons from strains of template DNA. Amplified fragments were resolved by agarose gel (1%) groups A, C, D, E, F, G respectively.
electrophoresis in TBE buffer followed by ethidium bromide staining.
Southern blot analysis of otr(A) and otr(B). PCR-amplified otr(A) tification results of all representatives from each group and otr(B) fragments were confirmed by Southern blot assays [10].
were alike. This analysis revealed the presence of 58 S.
Amplicons in agarose gels were transferred onto nylon membranes exfoliatus isolates (group A), 14 S. albidoflavus (group (Nytran SuperCharge, Schleicher & Schuell, Germany). Membranes B) and 30 S. viridosporus isolates (group C) and 42 were hybridized by digoxigenin-labelled DNA probes (Roche, isolates that could not be identified (Group D) in bulk Mannheim, Germany) generated by PCR amplification of otr(A) andotr(B) from S. rimosus ATTC 10970. Southern hybridization signals of soil samples. Seven isolates originating from the PCR products were detected using the DIG detection kit (Roche).
rhizosphere soil samples belonged to S. rochei cluster(group E) and 14 isolates to S. albidoflavus cluster Cloning and sequencing. PCR products obtained with otr(A) andotr(B) primers were ligated into the pCR 2.1 TOPO vector according to (group B). Isolates of group F, which were identified as the instructions of the manufacturer (Invitrogen, La Jolla, CA). After S. collinus strains, were found in both manure (21 transformation of TOPO10F competent cells (Invitrogen), clones were isolates) and seawater (five isolates) samples, whilst 15 picked and the presence of inserts of the expected size was assessed.
manure isolates belonging to group A were chara- Selected clones were then sequenced with vector-specific primers on a cterized as S. exfoliatus strains. Eight of the marine TcR PE-ABI377 sequencer (IMBB, Crete, Greece).
streptomycete strains were identified as S. rochei (groupE) and there were three marine isolates (group G) that Characterization of TcR streptomycete isolates. From all environmental samples, 217 TcR Streptomyces primers. Primers were designed for the detection of colonies were isolated. Out of these isolates, 66% otr(A) and otr(B)-like genes in streptomycetes (Table 3).
originated from bulk soil, 9.6% were isolates from The rationale of primer design was to specifically target rhizosphere soil samples, 16% were from manure the otr(A) and otr(B) genes found in S. rimosus, but also and 7.3% from seawater samples. Interestingly, no to amplify the homologous to otr(A) tetracycline resis- streptomycete growth was observed on plates inoculated tance gene tet found in the non-producer S. lividans and with activated sludge samples. All isolates were the trc3 gene found in the chlortetracycline producer S.
screened by analysis of 16S rRNA gene amplicons by aureofaciens, which is homologous to otr(B) (Table 1).
denaturing gradient gel electrophoresis. The band Control PCR tests were performed with E. coli strains position of isolates was examined and strains were carrying plasmids with other known TcR genes, non- assigned to seven migration groups based on the final homologous to otr genes. The absence of signals position in the gel (Fig. 1). Groups were not unique for indicated that the selected primers did not amplify TcR the samples. Four of the seven groups had isolates genes distant to the otr genes found in streptomycete originating from different samples. Randomly, ten strains. PCR products, of 778 bp for the otr(A) amplicon representatives from each of the groups (where a and 947 bp for the otr(B) amplicon, both amplified from group contained more than ten isolates) were selected S. rimosus were cloned and sequenced, to verify the and were further characterized phenotypically. Iden- specificity of the primers. Alignment of sequences Table 3. PCR primers, cycles of amplification, primer position and sizes of amplified DNA fragments of this study GAACACGTACTGACCGAGAAG 4 min/94°C, 35 · (1 min/94°C, 1 min/55°C, 2 min/72°C) and10 min/72°C CCGACATCTACGGGCGCAAGC 4 min/94°C, 35 · (1 min/94°C, 1 min/55°C, 2 min/72°C) and10 min/72°C a Genbank accession number and strain on which primers were based.
b Forward primer.
c Reverse primer.
Table 4. Streptomycete hosts of otr genes isolated from different environmental samples showed 100% similarity to the published sequences of detected in thirteen isolates: five S. exfoliatus from the respective genes from S. rimosus. No amplification Cotswold soil and antibiotic treated broiler chicken product was observed in PCR tests with chromosomal manure, five S. rochei isolated from rhizosphere soil DNA from tetracycline-sensitive streptomycete strains (untreated Ens site) and seawater (fishfarm and Evia such as S. griseus, S. coelicolor and S. fradiae.
Island), two S. viridosporus isolates from Dossenheimsoil and one S. albidoflavus from Cotswold soil and Distribution of otr determinants within strepto- (Table 4). The presence of the otr genes was confirmed mycete isolates. All 217 TcR streptomycetes were by sequencing the amplicons obtained from isolates.
analyzed for the presence of otr genes using PCR Comparison of these sequences showed that all three followed by hybridization with the appropriate probe.
otr(A)-amplicons and twelve otr(B)-amplicons were Only 15 isolates, obtained from dilution plates not 100% identical with the respective sequenced otr higher than 10)2, showed signals with any one of the probes, and one (S. rochei ER2 of marine origin) gave showed 92% similarity to the S. rimosus otr(B) gene positive hybridization with both probes. The otr(A) gene was detected in two isolates from the Dossenheim soilsamples identified as S. exfoliatus and S. viridosporus, and in one S. rochei strain from the seawater samplefrom Evia Island (Table 4). None of the rhizosphere soil This work is, to the best of our knowledge, the first or manure isolates carried otr(A). The otr(B) gene was attempt to study tetracycline resistance and to estimate T.L. Nikolakopoulou et al.: Distribution of Oxytetracycline Resistance the gene pool and flux of resistance genes in environ- Interestingly, most otr amplicons from the isolates mental streptomycetes. TcR streptomycetes were found shared 100% sequence identity with the sequences of otr in all samples, with the exception of sewage that pro- genes found in S. rimosus. The occurrence of identical vided no isolates. Although the taxonomic composition tetracycline resistance genes in different streptomycete varied among the environmental samples, only seven hosts provides additional support for the idea that hori- different streptomycete groups were found based on zontal gene transfers are the main events that help active DGGE analysis. An interesting observation was the exchange of such genes within the Streptomyces cluster absence of tetracycline-producing strains, such as S.
rimosus and S. aureofaciens, among the TcR isolates.
In this study, we provided more information on the This is in contrast with the findings of Egan and occurrence of tetracycline resistance genes otr(A) and coworkers [8] and Tolba and co-workers [23]. They otr(B) in a collection of streptomycete isolates from showed the majority of the streptomycin-resistant different environmental samples. Although previous streptomycetes isolated from soil samples were identi- studies [22] have addressed the prevalence of specific fied as S. griseus, a streptomycin-producing strain.
antibiotic resistances in the environment, none of the The present study indicated that only a small pro- studies on tetracycline resistance included streptomycete portion (7%) of the streptomycete isolates screened, populations in their investigations. The observation that with phenotypic resistance to tetracycline, contained tetracycline resistance was present in the apparent ab- otr(A) or otr(B). This is not the only case that pheno- sence of antibiotic selective pressure (bulk and rhizo- typically TcR isolates did not hybridize with any of the sphere soil, manure and seawater samples that have no tet probes studied [3]. This could imply that some of the obvious tetracycline contamination but carry strepto- isolates may carry tet genes that were not screened in mycetes with otr(A) and otr(B) genes) raises the ques- this study. For example, tet(K) and tet(L) genes are tion of how resistance persists. A recent study suggested widely distributed among Gram-positive species and that bacteria may have been able to adapt to the load of have been found in Mycobacterium, Nocardia and carrying resistance with little or no cost to their fitness Streptomyces spp. isolated from humans [6, 18]. How- [17]. In this scenario, the antibiotic-resistant microbiota ever it is shown that not all TcR Gram-positive bacteria would successfully compete with the sensitive pheno- have been reported to carry specific known tet genes types even in the absence of selection, which would make control of antibiotic resistance even more difficult.
The isolates that contained otr genes were taxo- nomically grouped within a range of four streptomycete taxa: S. exfoliatus, S. rochei, S. viridosporus and S.
albidoflavus, which are not known to produce tetracy- This study was financially supported by EU-BIOTECHgrant BIO4-CT98-0054 (RESERVOIR) and the European Union-funded Concerted clines. Out of these four groups, S. rochei and S. exfo- Action MECBAD (BIO4-CT98-0099). We are grateful to the President liatus could be considered the main reservoirs of the of the National Center of Marine Research, Dr. G. Chronis, and all the otr(A) and otr(B) genes in the screened habitats. Isolates researchers of the oceanographic ship ‘‘AGAIO’’ for assistance in the that hybridized with the otr probes were obtained not only from polluted habitats, but also from environmentswith limited or no obvious antibiotic selective pressure such as untreated bulk and rhizosphere soils. Our data 1. Aminov RI, Chee-Sanford JC, Garrigues N, Teferedegne B, Kra- showed that otr(B) gene was more frequently detected in pac IJ, White BA, Mackie RI (2002) Development, validation, andapplication of PCR primers for detection of tetracycline efflux the samples than otr(A) gene. This could imply that the genes of gram-negative bacteria. Appl Environ Microbiol efflux mechanism for resistance to tetracycline in streptomycete populations is dominant over the ribo- 2. Aminov RI, Garrigues-Jeanjean N, Mackie RI (2001) Molecular somal protection mechanism. An interesting property of ecology of tetracycline resistance: Development and validation of ribosomal protection is that it does not normally confer primers for detection of tetracycline resistance genes encodingribosomal protection proteins. Appl Environ Microbiol 76:22–23 high-level tetracycline resistance, as compared to the 3. Chopra I, Roberts MC (2001) Tetracycline antibiotics: mode of efflux genes, when cloned into E. coli. Thus, the ribo- action, applications, molecular biology and epidemiology of bac- somal protection mechanism of resistance might not terial resistance. Microbiol Mol Bio Rev 65:232–260 provide much survival value in the presence of tetra- 4. Dairi T, Aisaka K, Katsumata R, Hasegawa M (1995) A self- cycline in nature for the enteric bacteria [19]. However, defense gene homologous to tetracycline effluxing gene essentialfor antibiotic production in Streptomyces aureofaciens. Biosci there is no information available referring to levels of resistance that ribosomal protection mechanisms confer 5. Ditrich W, Schrempf H(1992) The unstable tetracycline resistance to Streptomyces sp. to support this idea.
gene of Streptomyces lividans 1326 encodes a putative protein with similarities to translational elongation factors and TetM and 15. Katsifas EA, Giannoutsou EP, Karagouni AD (1999) Diversity of TetO proteins. Antimicrob Agents Chemother 36:1119–1124 streptomycetes among specific Greek terrestrial ecosystems. Lett 6. Doran JL, Pang Y, Mdluli KE, Moran AJ, Victor TC, Stokes RW, van Helden E, Roberts MC, Nano FE (1997) Mycobacterium 16. McMurry LM, Levy SB (1998) Revised sequence of Otr(B) tuberculosis efpA encodes and efflux protein of the QacA trans- (Tet347) tetracycline efflux protein from Streptomyces rimosus.
porter family. Clin Diagn Lab Immunol 4:23–32 7. Doyle D, McDowell KJ, Butler MJ, Hunter IS (1991) Character- 17. Morris A, Kellner JD, Low DE (1998) The superbugs: evolution, ization of an oxytetracycline-resistance gene, otrA, of Streptomy- dissemination and fitness. Curr Opin Microbiol 1:526–529 18. Pang Y, Brown BA, Steingrube VA, Wallace RJ, Roberts MC 8. Egan S, Wiener P, Kallifidas D, Wellington EMH(1998) (1994) Tetracycline resistance determinants in Mycobacterium and Transfer of streptomycin biosynthesis gene clusters within strep- Streptomyces species. Antimicrob Agents Chemother 38:1408– tomycetes isolated from soil. Appl Environ Microbiol 64:5061– 19. Rhodes G, Huys G, Swings J, McGann P, Hiney M, Smith P, 9. Egan S, Wiener P, Kallifidas D, Wellington EMH(2001) Phy- Pickup RW (2000) Distribution of oxytetracycline resistance logeny of Streptomyces species and evidence for horizontal plasmids between aeromonads in hospital and aquaculture envi- transfer of entire and partial antibiotic gene clusters. Ant Van ronments: implication of Tn1721 in dissemination of the tetracy- cline resistance determinant tetA. Appl Environ Microbiol 10. Gçtz A, Pukall R, Smit E, Tietze E, Prager R, Tschäpe H, van Elsas JD, Smalla K (1996) Detection and characterization of 20. Roberts MC, Moncla BJ, Hillier SL (1991) Characterization of broad-host range plasmids in environmental bacteria by PCR.
unusal tetracycline-resistant gram-positive bacteria. Antimicrob 11. Heuer H, Krsek M, Baker P, Smalla K, Wellington EM (1997) 21. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a Analysis of actinomycete communities by specific amplification laboratory manual, 2nd edn. Cold Spring Harbor, NY: Cold–Spring of genes encoding 16S rRNA and gel-electrophoretic separation in denaturing gradients. Appl Environ Microbiol 63:3233– 22. Seveno N, Smalla K, van Elsas JD, Collard J-M, Karagouni A, Kallifidas D, Wellington EMH(2002) Occurrence and reservoirs 12. Heuer H, Krçgerrecklenfort E, Wellington EMH, Egan S, van of antibiotic resistance genes in the environment. Rev Med Elsas JD, van Overbeek L, Collard J-M, Guillaume G, Karagouni AD, Nikolakopoulou TL, Smalla K (2002) Gentamicin resistance 23. Tolba S, Egan S, Kallifidas D, Wellington EMH(2002) Distri- genes in environmental bacteria: prevalence and transfer. FEMS bution of streptomycin resistance and biosynthesis genes in streptomycetes recovered from different soil sites. FEMS Micro- 13. Hopwood DA, Bibb MJ, Chater KF, Kieser T, Bruton CJ, Kieser HM, Lydiate DJ, Smith C, Ward JM, Schrempf H (1985) Genetic 24. van Overbeek LS, Wellington EMH, Egan S, Smalla K, Heuer H, manipulation of Streptomyces, a laboratory manual, 1st edn., Vol Collard J-M, Guillaume G, Karagouni AD, Nikolakopoulou TL, van Elsas JD (2002) Prevalence of streptomycin-resistance genes 14. Huys G, Rhodes G, McGann P, Denys R, Pickup R, Hiney M, in bacterial populations in European habitats. FEMS Microbiol Smith P, Swings J (2000) Characterization of oxytetracycline- resistant heterotrophic bacteria originating from hospital and 25. Williams ST, Goodfellow M, Wellington EMH(1983) A proba- freshwater fishfarm environments in England and Ireland. Syst bility matrix for identification of some streptomycetes. J Gen

Source: http://users.uoa.gr/~akar/other/ergasia32.pdf